Приложение 4
к МР 3.1.0272-22


В настоящее время (на 10.01.2022) к вариантам ВЭП (VOC) относятся штаммы, принадлежащие к линиям:

— Alpha, B.1.1.7 («Британский»);

— Beta, B.1.351 («ЮАР»);

— Gamma, P.1 линии B.1.1.28 («Бразильский»);

— Kappa, B.1.617.1 («Индийский.1»);

— Delta, B.1.617.2 («Индийский.2»).

— Omicron, B.1.1.529 («Южно-Африканский»)

К вариантам ТДИ (VUI) (на 12.06.2021) относятся:

— AT.1 линии B.1.1.370.1;

— B.1.1.523 (ранее относился к линии B.1.1.451, согласно PANGOILIN)

Ниже приводятся рекомендации по дифференциации вышеуказанных геновариантов с помощью методов (1) фрагментного секвенирования по Сэнгеру отдельных локусов гена, кодирующего S-белок, (2) секвенирования по Сэнгеру полного гена S-белка, (3) полногеномного секвенирования.

Информация о характерных мутациях S-гена для каждой линии приведена в таблице 1.

Таблица 1. Характерные мутации S-гена геновариантов ВЭП и ТДИ.

Мутации гена S
Alpha, B.1.1.7H69-, V70-, Y144-, N501Y, A570D, D614G, P681H, T716I, S982A, D1118H
Beta, B.1.351D80A, D215G, L241-, L242-, A243-, K417N, E484K, N501Y, D614G, A701V
Gamma, P.1L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, D614G, H655Y, T1027I, V1176F
Delta, B.1.617.2T19R, E156-, F157-, R158G, L452R, T478K, D614G, P681R, D950N
Kappa, B.1.617.1G142D, E154K, L452R, E484Q, D614G, P681R, Q1071H
AT.1 линии B.1.1.370.1P9L, D215G, C136-, N137-, D138-, P139-, F140-, L141-, G142-, V143-, Y144-, H245P, F306I, T307S, V308C, E309R, K310S, G311V, I312L, E484K, N679K, ins_679_GIAL, E780K
B.1.1.523E156-, F157-, R158-, F306L, E484K, S494P, E780A

1. Алгоритм дифференциации генетических вариантов вируса SARS-CoV-2 с помощью фрагментного секвенирования по Сэнгеру отдельных локусов гена, кодирующего S-белок.

Дифференциацию геновариантов вируса SARS-CoV-2 по локусам из протоколов Университета Женевы и ARTIC осуществляют в соответствии с таблицей 2, определяя делеции 21765-21770 (делеция HV 69-70), 21991-21993 (делеция Y144), 22287-22295 (делеция LAL 242-244), 21969-21995 (делеция CNDPFLGNY 136-144), замены A21801C (замена D80A), G21974T (замена D138Y), G22132T (замена R190S), A22206G (замена D215G), A22296C (замена H245P), T22917G (замена L452R), C22995A (замена T478K), G23012A (замена E484K), G23012C (замена E484Q), A23063T (замена N501Y), C23271A (замена A570D). Нумерация нуклеотидных остатков приведена относительно референс-штамма hCoV-19/Wuhan/WIV04/2019 (EPI_ISL_402124).

На идентификацию геноварианта B.1.1.7 («Британский») направлено обнаружение при секвенировании фрагмента F44-R44 или nCoV-2019_72 делеций 21765-21770 (HIV 69-70), 21991-21993 (Y144), а также обнаружение замены A23063T (N501Y) при секвенировании фрагмента F47-R47 или nCoV-2019_76, замены C23271A (A570D) при секвенировании фрагмента F47-R47 или nCoV-2019_77.

На идентификацию геноварианата B.1.351 («ЮАР») направлено обнаружение при секвенировании фрагмента F44-R44 или nCoV-2019_72 замены A21801C (D80A), а также обнаружение делеции 22287-22295 (LAL 242-244) и замены A22206G (D215G) при секвенировании фрагмента nCoV-2019_73, замен G23012A (E484K) и A23063T (N501Y) при секвенировании фрагмента F47-R47 или nCoV-2019_76.

На идентификацию геноварианата — P.1 линии B.1.1.28 («Бразильский») направлено обнаружение при секвенировании фрагмента F44-R44 или nCoV-2019_72, замены G21974T (D138Y), а также обнаружение замены G22132T (R190S) при секвенировании фрагмента nCoV-2019_73, замен G23012A (E484K) и A23063T (N501Y) при секвенировании фрагмента F47-Я47 или nCoV-2019_76.

На идентификацию геноварианата B.1.617.1 («Индийский. 1») направлено обнаружение при секвенировании nCoV-2019_76 замен T22917G (L452R) и G23012C (E484Q) для филогенетической линии B.1.617.1 и замен T22917G (L452R).

На идентификацию геноварианата B.1.617.2 («Индийский.2») направлено обнаружение при секвенировании nCoV-2019_76 замен T22917G (L452R) и G23012C (E484Q) для филогенетической линии B.1.617.1 и замен T22917G (L452R), а также C22995A (T478K) для филогенетической линии B.1.617.2.

На идентификацию геноварианта B.1.1.523 направлено обнаружение при секвенировании фрагмента F44-R45 или nCoV-2019_(72_Left+73_Right) делеции 22029-22037 (EFR 156-158), замен G23012A (E484K) и t23042c (S494P) при секвенировании фрагмента F47-R47 или nCoV-2019_76.

На идентификацию геноварианта AT.1 линии B.1.1.370.1 направлено обнаружение при секвенировании фрагмента F44-R44 или nCoV-2019_72 делеции 21969-21995 (CNDPFLGNY 136-144), а также обнаружение замен A22206G (D215G), A22296C (H245P) при секвенировании фрагмента nCoV-2019_73, замены G23012A (E484K) при секвенировании фрагмента F47-R47 или nCoV-2019_76.

Таблица 2. Список мутаций генетических вариантов вируса SARS-CoV-2, детектируемых при фрагментом секвенировании

По протоколу Университета ЖеневыПо протоколу ARTIC v.3Генетические варианты SARS-CoV-2
Фрагмент F44-R45, внутренний фрагмент F44-R44 <1>Фрагмент F46-R47, внутренний фрагмент F47-R47Фрагмент nCoV-2019_72Фрагмент nCoV-2019_73Фрагмент nCoV-2019_76Фрагмент nCoV-2019_77
Делеция HIV69-70, Y144 Замены N501Y


Делеция HIV69-70, Y144нетЗамена N501YЗамена A570DAlpha B.1.1.7 (Британский)
Замена D80A Замены N501Y


Замена D80A Делеция LAL 242-244

Замена D215G

Замены N501Y


нетBeta B.1.351 (ЮАР)
Замена D138Y Замены N501Y


Замена D138YЗамена R190S Замены N501Y


нетGamma P.1, B.1.1.28 (Бразилия)
Замены G142D

<2> E154K <2>

Замены L452R <3> E484Q Замена T95I <2>


нет Замены L452R


нетKappa B.1.617.1 (Индия.1)
Делеция FR156-157 <1>

Замена R158G <1>

Замены L452R <3>

T478K <3>

нет Делеция FR156-157 <1>

Замена R158G <1>

Замены L452R


нетDelta B.1.617.2 (Индия.2) <1>
Делеция EFR156-158 <1> E484K


нетДелеция EFR156-158 E484K


Делеция CNDPFLGNY 136-144E484K <1>Делеция CNDPFL GNY 136-144Замена <5> D215G H245PE484KнетAT.1 линии B.1.1.370.1 (северо-западный) <4>, <5>

<1> Использование праймера R44 из протокола Университета Женевы и nCoV-2019_72_Right из протокола ARTIC v.3 может быть неэффективным для идентификации геноварианта B.1.617.2 (Индия.2)! (праймеры относятся к зоне делеции).

<2> Наличие данных замен и/или делеций является возможным, но не определяющим. Определяющими стоит считать замены в положениях 452, 478, 484.

<3> Идентификация данных замен возможна только при секвенировании фрагмента F46-R47.

<4> В случае геноварианта AT.1 линии B.1.1.370.1 (северо-западный) использование праймера F46 из протокола Университета Женевы может быть неэффективным!

<5> При определении геноварианта AT.1 линии B.1.1.370.1 (северо-западный) использование праймера nCoV-2019_73_Left из протокола ARTIC v.3 невозможно!

Рекомендуемые протоколы исследования с помощью фрагментного секвенирования по Сэнгеру отдельных локусов гена, кодирующего S-белок:

Для амплификации участков, содержащих нуклеотидные замены, необходимые для определения геновариантов вируса SARS-CoV-2, используют олигонуклеотидные праймеры, указанные в Протоколе Университета Женевы (Geneva, December 26th, 2020, Rue Gabrielle-Perret-Gentil 4, 1211 Geneva 14, Switzerland), см таблицу 3.

Таблица 3. Праймеры используемые по протоколу Университета Женевы.

ОбозначениеПоследовательность (5′-3′)

<1> Использование праймера R44 из протокола Университета Женевы может быть неэффективным для идентификации геноварианта B.1.617.2 (Индия.2)! (праймеры попадают в зону делеций).

<2> В случае геноварианта AT.1 линии B.1.1.370.1 (северо-западный) использование праймера F46 из протокола Университета Женевы может быть неэффективным!

При исследовании проб с низкими значениями Ct <= 20 (высокая вирусная нагрузка) достаточно одного раунда ПЦР с праймерами F44-R44 и F47-R47, обеспечивающими образование фрагментов 570 п.н. и 565 п.н., соответственно.

При исследовании проб с высокими значениями Ct >= 25 (низкая вирусная нагрузка) используется гнездовая ПЦР.

Первоначально проводят амплификацию с праймерами F44-R45 и F46-R47, фланкирующими фрагменты размером 1071 п.н. и 1068 п.н., а затем осуществляют вторую ПЦР с праймерами F44-R44 и F47-R47, где в качестве исследуемой ДНК используют ампликоны, полученные в первом раунде, см. таблицу 4.

Таблица 4. Рекомендуемые условия проведения реакции амплификации при использовании Протокола Университета Женевы.

Матричный режим1 этап2 этап5 этап6 этап
95 °C — 5 мин 95 °C — 30 с

55 °C — 30 с

72 °C — 70 с

38 циклов

72 °C — 4 мин10 °C — хранение

В качестве альтернативного способа рекомендуется использовать пары праймеров nCoV-2019_72, nCoV-2019_76 и nCoV-2019_77 из протокола ARTIC v.3 (nCoV-2019 sequencing protocol v3 (LoCost) (protocols.io), см. таблицу 5.

Таблица 5. Праймеры используемые по протоколу ARTIC v.3.

ОбозначениеПоследовательность (5′-3′)

Рекомендуемые условия проведения реакции амплификации при использовании Протокола ARTIC v.3 см. таблица 6.

Таблица 6. Рекомендуемые условия проведения реакции амплификации при использовании протокола ARTIC v.3

Матричный режим1 этап3 этап4 этап5 этап6 этап
95 °C — 5 мин 95 °C — 60 с

62 °C — 60 с

72 °C — 60 с

10 циклов

95 °C — 30 с

60 °C — 30 с

72 °C — 30 с

30 циклов

72 °C — 5 мин10 °C — хранение

Допустимо также использовать праймеры из иных протоколов, позволяющие проводить амплификацию и последующее фрагментное секвенирование участков генома SARS-CoV-2, содержащих перечисленные нуклеотидные замены.

В качестве замены праймерам R44 из протокола Университета Женевы и nCoV-2019_72_Right из протокола ARTIC v.3 может быть использован праймер CACV_51_R, праймеру F46 из протокола Университета Женевы — праймер CACV_55_F и праймеру nCoV-2019_73_Left из протокола ARTIC v.3 — праймер CACV_52_F (таблица 7).

Таблица 7. Праймеры, рекомендуемые для замены неработающих поаймеров из протоколов Университета Женевы и протокола ARTIC v.3

НазваниеПоследовательность 5′-3′Длина, пн

2. Алгоритм дифференциации генетических вариантов вируса SARS-CoV-2 с помощью фрагментного секвенирования полной последовательности гена, кодирующего S-белок.

Для дифференциации генетических вариантов вируса SARS-CoV-2 с помощью фрагментного секвенирования полной последовательности гена, кодирующего S-белок предлагается использовать тот же алгоритм, что и указанный выше для фрагментного секвенирования отдельных локусов.

Для амплификации полного гена S, необходимого для определения геновариантов вируса SARS-CoV-2, используют олигонуклеотидные праймеры из протокола ARTIC v3, перекрывающие полную нуклеотидную последовательность гена S SARS-CoV-2 длиной 3822 нуклеотидных оснований (позиция в геноме 21562 — 25384 н.о.).

Их последовательности и позиции в геноме, а также длина ожидаемых ампликонов, указаны ниже (см. таблица 8). Рекомендуемые условия проведения реакции амплификации при использовании протокола ARTIC v.3 приведены в таблице 8.

Таблица 8. Нуклеотидные последовательности и позиции в геноме олигонуклеотидных праймеров для секвенирования гена S SARS-CoV-2 (протокол ARTIC v3).


<*> ВНИМАНИЕ! Структура праймера N 1 (nCoV-2019_72_LEFT_alt) является уникальной, не входит в набор оригинального протокола ARTIC v3 и требует отдельного заказа.

nameПозицияseqlength%gcДлина ампликона
1nCoV-2019_72_LEFT_alt21508 — 21544FGAGTTGTTATTTCTAGTGATGTTCTTG2733.00530
2nCoV-2019_72_RIGHT22014 — 22038ACTCTGAACTCACTTTCCATCCAAC2544.00
3nCoV-2019_73_LEFT21962 — 21990CAATTTTGTAATGATCCATTTTTGGGTGT2931.03384
4nCoV-2019_73_RIGHT22327 — 22346CACCAGCTGTCCAACCTGAAGA2254.55
5nCoV-2019_74_LEFT22263 — 22290ACATCACTAGGTTTCAAACTTTACTTGC2835.71387
6nCoV-2019_74_RIGHT22627 — 22650GCAACACAGTTGCTGATTCTCTTC2445.83
7nCoV-2019_75_LEFT22517 — 22542AGAGTCCAACCAACAGAATCTATTGT2638.46386
9nCoV-2019_76_LEFT_alt322799 — 22821GGGCAAACTGGAAAGATTGCTGA2347.83413
10nCoV-2019_76_RIGHT_alt023190 — 23212ACCTGTGCCTGTTAAACCATTGA2343.48
11nCoV-2019_77_LEFT23123 — 23144CCAGCAACTGTTTGTGGACCTA2250.00399
12nCoV-2019_77_RIGHT23501 — 23522CAGCCCCTATTAAACAGCCTGC2254.55
13nCoV-2019_78_LEFT23444 — 23466CAACTTACTCCTACTTGGCGTGT2347.83403
14nCoV-2019_78_RIGHT23823 — 23847TGTGTACAAAAACTGCCATATTGCA2536.00
15nCoV-2019_79_LEFT23790 — 23812GTGGTGATTCAACTGAATGCAGC2347.83379
16nCoV-2019_79_RIGHT24146 — 24169CATTTCATCTGTGAGCAAAGGTGG2445.83
17nCoV-2019_80_LEFT24079 — 24100TTGCCTTGGTGATATTGCTGCT9945.45388
18nCoV-2019_80_RIGHT24444 — 24467TGGAGCTAAGTTGTTTAACAAGCG2441.67
19nCoV-2019_81_LEFT24292 — 24416GCACTTGGAAAACTTCAAGATGTGG2544.00497
20nCoV-2019_81_RIGHT24766 — 24789GTGAAGTTCTTTTCTTGTGCAGGG2445.83
21nCoV-2019_82_LEFT24697 — 24721GGGCTATCATCTTATGTCCTTCCCT2548.00379
22nCoV-2019_82_RIGHT25053 — 25076TGCCAGAGATGTCACCTAAATCAA2441.67
23nCoV-2019_83_LEFT24979 — 25003TCCTTTGCAACCTGAATTAGACTCA2540.00390
24nCoV-2019_83_RIGHT25401 — 25369TTTGACTCCTTTGAGCACTGGC2250.00

Таблица 9. Рекомендуемые условия проведения реакции амплификации при использовании праймеров из протокола ARTIC v3. <*>

Матричный режим1 этап3 этап <*>5 этап6 этап
95 °C — 30 с 95 °C — 30 с

55 °C — 10 с

72 °C — 40 с

30 — 35 циклов

72 °C — 2 мин10 °C — хранение

<*> Данный температурный режим указан для протокола на основе  High-Fidelity DNA Polymerase. При использовании других ферментов может потребоваться проведение оптимизации условий реакции.

При невозможности использования праймеров из протокола ARTIC v.3 предлагается использовать альтернативный набор праймеров из протокола ЦНИИЭ (неопубликованные данные) или отдельные праймеры, см. таблица 10.

Таблица 10. Нуклеотидные последовательности и позиции в геноме олигонуклеотидных праймеров для секвенирования гена S SARS-CoV-2 (протокол ЦНИИЭ).

Название праймераПозицияПоследовательность 5′-3′ДлинаДлина ампликона, пн
Cacv51_F21420 — 21440AAG GGG TAC TGC TGT TAT GTC21795
Cacv51_R22195 — 22214GAG GGA GAT CAC GCA CTA AA20
Cacv52_F22016 — 22037TGG ATG GAA AGT GAG TTC AGA G22526
Cacv52_R22518 — 22541CAA TAG ATT CTG TTG GTT GGA CTC24
Cacv55_F22407 — 22430ATG GAA CCA TTA C AG ATG CTG TAG24585
Cacv55_R22971 — 22991TAC CGG CCT GAT AGA TTT CAG21
Cacv07_F22842 — 22861ATG ATT TTA CAG GCT GCG TT20637
Cacv08_R23072 — 23091CCT GTA GAA TAA ACA CGC CA20
Cacv81_F23261 — 23282AGA GAC ATT GCT GAC ACT ACT G22585
Cacv81_R23821 — 23845TGT ACA AAA ACT GCC ATA TTG CAA C25
Cacv82_F23684 — 23709TCT AAT AAC TCT ATT GCC ATA CCC AC26538
Cacv82_R24200 — 24221TCC AAC CAG AAG TGA TTG TAC C22
Cacv83_F24122 — 24145AAG TTT AAC GGC CTT ACT GTT TTG24592
Cacv83_R24690 — 24713ACA TAA GAT GAT AGC CCT TTC CAC24
Cacv84_F24587 — 24611ACT CAA CAA TTA ATT AGA GCT GCA G25585
Cacv84_R25149 — 25171AAG TTC TTG GAG ATC GAT GAG AG23
Cacv85_F24810 — 24833ATG ATG GAA AAG CAC ACT TTC CTC24666
Cacv09_R25281 — 25300AAA TCT GAA GGA GTA GCA TCC TTG24

Рекомендуемые условия проведения реакции амплификации при использовании праймеров из протокола ЦНИИЭ приведены в таблице 11.

Таблица 11. Рекомендуемые условия проведения реакции амплификации при использовании праймеров из протокола ЦНИИЭ.

Матричный режим1 этап3 этап <*>5 этап6 этап
95 °C — 5 мин 95 °C — 30 с

52 °C — 30 с

72 °C — 60 с

30 — 35 циклов

72 °C — 5 мин10 °C — хранение

<*> Данный температурный режим указан для протокола на основе Taq-полимеразы. При использовании других ферментов может потребоваться проведение оптимизации условий реакции.

Допустимо также использовать праймеры из иных протоколов, позволяющие проводить амплификацию и последующее фрагментное секвенирование последовательности S-гена SARS-CoV-2.

3. Алгоритм дифференциации генетических вариантов вируса SARS-CoV-2 с помощью проведения полногеномного секвенирования

Для заключения о геноварианте SARS-CoV-2 в исследованной пробе рекомендуется использовать алгоритм классификации PANGOLIN (https://cov-lineages.org/).

Для секвенирования полной последовательности геномов SARS-CoV-2 рекомендуется использовать (на выбор) праймерную панель и протокол подготовки библиотек:

— ARTIC v.3 https://www.protocols.io/view/ncov-2019-sequencing-protocol-bbmuik6w

— SCV-2000bp https://www.protocols.io/view/protocol-for-scv-2000bp-a-primer-panel-for-sars-co-bn77mhrn.html

— любые иные праймерные панели и протоколы, позволяющие осуществить амплификацию полного генома SARS-CoV-2″.


6 + 10 =