Перечень идентифицируемых генетических вариантов SARS-CoV-2 - MED-KATALOG.SITE
Меню Закрыть

Перечень идентифицируемых генетических вариантов SARS-CoV-2

Приложение 4
к МР 3.1.0272-22

ПЕРЕЧЕНЬ ИДЕНТИФИЦИРУЕМЫХ ГЕНЕТИЧЕСКИХ ВАРИАНТОВ SARS-COV-2

В настоящее время (на 10.01.2022) к вариантам ВЭП (VOC) относятся штаммы, принадлежащие к линиям:

— Alpha, B.1.1.7 («Британский»);

— Beta, B.1.351 («ЮАР»);

— Gamma, P.1 линии B.1.1.28 («Бразильский»);

— Kappa, B.1.617.1 («Индийский.1»);

— Delta, B.1.617.2 («Индийский.2»).

— Omicron, B.1.1.529 («Южно-Африканский»)

К вариантам ТДИ (VUI) (на 12.06.2021) относятся:

— AT.1 линии B.1.1.370.1;

— B.1.1.523 (ранее относился к линии B.1.1.451, согласно PANGOILIN)

Ниже приводятся рекомендации по дифференциации вышеуказанных геновариантов с помощью методов (1) фрагментного секвенирования по Сэнгеру отдельных локусов гена, кодирующего S-белок, (2) секвенирования по Сэнгеру полного гена S-белка, (3) полногеномного секвенирования.

Информация о характерных мутациях S-гена для каждой линии приведена в таблице 1.

Таблица 1. Характерные мутации S-гена геновариантов ВЭП и ТДИ.

Мутации гена S
Alpha, B.1.1.7 H69-, V70-, Y144-, N501Y, A570D, D614G, P681H, T716I, S982A, D1118H
Beta, B.1.351 D80A, D215G, L241-, L242-, A243-, K417N, E484K, N501Y, D614G, A701V
Gamma, P.1 L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, D614G, H655Y, T1027I, V1176F
Delta, B.1.617.2 T19R, E156-, F157-, R158G, L452R, T478K, D614G, P681R, D950N
Kappa, B.1.617.1 G142D, E154K, L452R, E484Q, D614G, P681R, Q1071H
AT.1 линии B.1.1.370.1 P9L, D215G, C136-, N137-, D138-, P139-, F140-, L141-, G142-, V143-, Y144-, H245P, F306I, T307S, V308C, E309R, K310S, G311V, I312L, E484K, N679K, ins_679_GIAL, E780K
B.1.1.523 E156-, F157-, R158-, F306L, E484K, S494P, E780A
B.1.1.529

1. Алгоритм дифференциации генетических вариантов вируса SARS-CoV-2 с помощью фрагментного секвенирования по Сэнгеру отдельных локусов гена, кодирующего S-белок.

Дифференциацию геновариантов вируса SARS-CoV-2 по локусам из протоколов Университета Женевы и ARTIC осуществляют в соответствии с таблицей 2, определяя делеции 21765-21770 (делеция HV 69-70), 21991-21993 (делеция Y144), 22287-22295 (делеция LAL 242-244), 21969-21995 (делеция CNDPFLGNY 136-144), замены A21801C (замена D80A), G21974T (замена D138Y), G22132T (замена R190S), A22206G (замена D215G), A22296C (замена H245P), T22917G (замена L452R), C22995A (замена T478K), G23012A (замена E484K), G23012C (замена E484Q), A23063T (замена N501Y), C23271A (замена A570D). Нумерация нуклеотидных остатков приведена относительно референс-штамма hCoV-19/Wuhan/WIV04/2019 (EPI_ISL_402124).

На идентификацию геноварианта B.1.1.7 («Британский») направлено обнаружение при секвенировании фрагмента F44-R44 или nCoV-2019_72 делеций 21765-21770 (HIV 69-70), 21991-21993 (Y144), а также обнаружение замены A23063T (N501Y) при секвенировании фрагмента F47-R47 или nCoV-2019_76, замены C23271A (A570D) при секвенировании фрагмента F47-R47 или nCoV-2019_77.

На идентификацию геноварианата B.1.351 («ЮАР») направлено обнаружение при секвенировании фрагмента F44-R44 или nCoV-2019_72 замены A21801C (D80A), а также обнаружение делеции 22287-22295 (LAL 242-244) и замены A22206G (D215G) при секвенировании фрагмента nCoV-2019_73, замен G23012A (E484K) и A23063T (N501Y) при секвенировании фрагмента F47-R47 или nCoV-2019_76.

На идентификацию геноварианата — P.1 линии B.1.1.28 («Бразильский») направлено обнаружение при секвенировании фрагмента F44-R44 или nCoV-2019_72, замены G21974T (D138Y), а также обнаружение замены G22132T (R190S) при секвенировании фрагмента nCoV-2019_73, замен G23012A (E484K) и A23063T (N501Y) при секвенировании фрагмента F47-Я47 или nCoV-2019_76.

На идентификацию геноварианата B.1.617.1 («Индийский. 1») направлено обнаружение при секвенировании nCoV-2019_76 замен T22917G (L452R) и G23012C (E484Q) для филогенетической линии B.1.617.1 и замен T22917G (L452R).

На идентификацию геноварианата B.1.617.2 («Индийский.2») направлено обнаружение при секвенировании nCoV-2019_76 замен T22917G (L452R) и G23012C (E484Q) для филогенетической линии B.1.617.1 и замен T22917G (L452R), а также C22995A (T478K) для филогенетической линии B.1.617.2.

На идентификацию геноварианта B.1.1.523 направлено обнаружение при секвенировании фрагмента F44-R45 или nCoV-2019_(72_Left+73_Right) делеции 22029-22037 (EFR 156-158), замен G23012A (E484K) и t23042c (S494P) при секвенировании фрагмента F47-R47 или nCoV-2019_76.

На идентификацию геноварианта AT.1 линии B.1.1.370.1 направлено обнаружение при секвенировании фрагмента F44-R44 или nCoV-2019_72 делеции 21969-21995 (CNDPFLGNY 136-144), а также обнаружение замен A22206G (D215G), A22296C (H245P) при секвенировании фрагмента nCoV-2019_73, замены G23012A (E484K) при секвенировании фрагмента F47-R47 или nCoV-2019_76.

Таблица 2. Список мутаций генетических вариантов вируса SARS-CoV-2, детектируемых при фрагментом секвенировании

По протоколу Университета Женевы По протоколу ARTIC v.3 Генетические варианты SARS-CoV-2
Фрагмент F44-R45, внутренний фрагмент F44-R44 <1> Фрагмент F46-R47, внутренний фрагмент F47-R47 Фрагмент nCoV-2019_72 Фрагмент nCoV-2019_73 Фрагмент nCoV-2019_76 Фрагмент nCoV-2019_77
Делеция HIV69-70, Y144 Замены N501Y

A570D

Делеция HIV69-70, Y144 нет Замена N501Y Замена A570D Alpha B.1.1.7 (Британский)
Замена D80A Замены N501Y

E484K

Замена D80A Делеция LAL 242-244

Замена D215G

Замены N501Y

E484K

нет Beta B.1.351 (ЮАР)
Замена D138Y Замены N501Y

E484K

Замена D138Y Замена R190S Замены N501Y

E484K

нет Gamma P.1, B.1.1.28 (Бразилия)
Замены G142D

<2> E154K <2>

Замены L452R <3> E484Q Замена T95I <2>

G142D

нет Замены L452R

E484Q

нет Kappa B.1.617.1 (Индия.1)
Делеция FR156-157 <1>

Замена R158G <1>

Замены L452R <3>

T478K <3>

нет Делеция FR156-157 <1>

Замена R158G <1>

Замены L452R

T478K

нет Delta B.1.617.2 (Индия.2) <1>
Делеция EFR156-158 <1> E484K

S494P

нет Делеция EFR156-158 E484K

S494P

нет B.1.1.523
Делеция CNDPFLGNY 136-144 E484K <1> Делеция CNDPFL GNY 136-144 Замена <5> D215G H245P E484K нет AT.1 линии B.1.1.370.1 (северо-западный) <4>, <5>

<1> Использование праймера R44 из протокола Университета Женевы и nCoV-2019_72_Right из протокола ARTIC v.3 может быть неэффективным для идентификации геноварианта B.1.617.2 (Индия.2)! (праймеры относятся к зоне делеции).

<2> Наличие данных замен и/или делеций является возможным, но не определяющим. Определяющими стоит считать замены в положениях 452, 478, 484.

<3> Идентификация данных замен возможна только при секвенировании фрагмента F46-R47.

<4> В случае геноварианта AT.1 линии B.1.1.370.1 (северо-западный) использование праймера F46 из протокола Университета Женевы может быть неэффективным!

<5> При определении геноварианта AT.1 линии B.1.1.370.1 (северо-западный) использование праймера nCoV-2019_73_Left из протокола ARTIC v.3 невозможно!

Рекомендуемые протоколы исследования с помощью фрагментного секвенирования по Сэнгеру отдельных локусов гена, кодирующего S-белок:

Для амплификации участков, содержащих нуклеотидные замены, необходимые для определения геновариантов вируса SARS-CoV-2, используют олигонуклеотидные праймеры, указанные в Протоколе Университета Женевы (Geneva, December 26th, 2020, Rue Gabrielle-Perret-Gentil 4, 1211 Geneva 14, Switzerland), см таблицу 3.

Таблица 3. Праймеры используемые по протоколу Университета Женевы.

Обозначение Последовательность (5′-3′)
F44 TCTCTTCTTAGTAAAGGTAGACTT
F46 <2> CCTTCACTGTAGAAAAAGGAATC
F47 TATCAGGCCGGTAGCACAC
R45 CTAACAATAGATTCTGTTGGTTG
R44 <1> GAATAAACTCTGAACTCACTTTCC
R47 CATATGAGTTGTTGACATGTTCAG

<1> Использование праймера R44 из протокола Университета Женевы может быть неэффективным для идентификации геноварианта B.1.617.2 (Индия.2)! (праймеры попадают в зону делеций).

<2> В случае геноварианта AT.1 линии B.1.1.370.1 (северо-западный) использование праймера F46 из протокола Университета Женевы может быть неэффективным!

При исследовании проб с низкими значениями Ct <= 20 (высокая вирусная нагрузка) достаточно одного раунда ПЦР с праймерами F44-R44 и F47-R47, обеспечивающими образование фрагментов 570 п.н. и 565 п.н., соответственно.

При исследовании проб с высокими значениями Ct >= 25 (низкая вирусная нагрузка) используется гнездовая ПЦР.

Первоначально проводят амплификацию с праймерами F44-R45 и F46-R47, фланкирующими фрагменты размером 1071 п.н. и 1068 п.н., а затем осуществляют вторую ПЦР с праймерами F44-R44 и F47-R47, где в качестве исследуемой ДНК используют ампликоны, полученные в первом раунде, см. таблицу 4.

Таблица 4. Рекомендуемые условия проведения реакции амплификации при использовании Протокола Университета Женевы.

Матричный режим 1 этап 2 этап 5 этап 6 этап
95 °C — 5 мин 95 °C — 30 с

55 °C — 30 с

72 °C — 70 с

38 циклов

72 °C — 4 мин 10 °C — хранение

В качестве альтернативного способа рекомендуется использовать пары праймеров nCoV-2019_72, nCoV-2019_76 и nCoV-2019_77 из протокола ARTIC v.3 (nCoV-2019 sequencing protocol v3 (LoCost) (protocols.io), см. таблицу 5.

Таблица 5. Праймеры используемые по протоколу ARTIC v.3.

Обозначение Последовательность (5′-3′)
nCoV-2019_72_LEFT ACACGTGGTGTTTATTACCCTGAC
nCoV-2019_72_RIGHT ACTCTGAACTCACTTTCCATCCAAC
nCoV-2019_73_LEFT CAATTTTGTAATGATCCATTTTTGGGTGT
nCoV-2019_73_RIGHT CACCAGCTGTCCAACCTGAAGA
nCoV-2019_76_LEFT AGGGCAAACTGGAAAGATTGCT
nCoV-2019_76_RIGHT ACACCTGTGCCTGTTAAACCAT
nCoV-2019_76_LEFT_alt3 GGGCAAACTGGAAAGATTGCTGA
nCoV-2019_76_RIGHT_alt0 ACCTGTGCCTGTTAAACCATTGA
nCoV-2019_77_LEFT CCAGCAACTGTTTGTGGACCTA

Рекомендуемые условия проведения реакции амплификации при использовании Протокола ARTIC v.3 см. таблица 6.

Таблица 6. Рекомендуемые условия проведения реакции амплификации при использовании протокола ARTIC v.3

Матричный режим 1 этап 3 этап 4 этап 5 этап 6 этап
95 °C — 5 мин 95 °C — 60 с

62 °C — 60 с

72 °C — 60 с

10 циклов

95 °C — 30 с

60 °C — 30 с

72 °C — 30 с

30 циклов

72 °C — 5 мин 10 °C — хранение

Допустимо также использовать праймеры из иных протоколов, позволяющие проводить амплификацию и последующее фрагментное секвенирование участков генома SARS-CoV-2, содержащих перечисленные нуклеотидные замены.

В качестве замены праймерам R44 из протокола Университета Женевы и nCoV-2019_72_Right из протокола ARTIC v.3 может быть использован праймер CACV_51_R, праймеру F46 из протокола Университета Женевы — праймер CACV_55_F и праймеру nCoV-2019_73_Left из протокола ARTIC v.3 — праймер CACV_52_F (таблица 7).

Таблица 7. Праймеры, рекомендуемые для замены неработающих поаймеров из протоколов Университета Женевы и протокола ARTIC v.3

Название Последовательность 5′-3′ Длина, пн
CACV_51_R GAG GGA GAT CAC GCA CTA AA 20
CACV_55_F ATG GAA CCA TTA CAG ATG CTG TAG 24
CACV_52_F TGG ATG GAA AGT GAG TTC AGA G 22

2. Алгоритм дифференциации генетических вариантов вируса SARS-CoV-2 с помощью фрагментного секвенирования полной последовательности гена, кодирующего S-белок.

Для дифференциации генетических вариантов вируса SARS-CoV-2 с помощью фрагментного секвенирования полной последовательности гена, кодирующего S-белок предлагается использовать тот же алгоритм, что и указанный выше для фрагментного секвенирования отдельных локусов.

Для амплификации полного гена S, необходимого для определения геновариантов вируса SARS-CoV-2, используют олигонуклеотидные праймеры из протокола ARTIC v3, перекрывающие полную нуклеотидную последовательность гена S SARS-CoV-2 длиной 3822 нуклеотидных оснований (позиция в геноме 21562 — 25384 н.о.).

Их последовательности и позиции в геноме, а также длина ожидаемых ампликонов, указаны ниже (см. таблица 8). Рекомендуемые условия проведения реакции амплификации при использовании протокола ARTIC v.3 приведены в таблице 8.

Таблица 8. Нуклеотидные последовательности и позиции в геноме олигонуклеотидных праймеров для секвенирования гена S SARS-CoV-2 (протокол ARTIC v3).

———————————

<*> ВНИМАНИЕ! Структура праймера N 1 (nCoV-2019_72_LEFT_alt) является уникальной, не входит в набор оригинального протокола ARTIC v3 и требует отдельного заказа.

name Позиция seq length %gc Длина ампликона
1 nCoV-2019_72_LEFT_alt 21508 — 21544 FGAGTTGTTATTTCTAGTGATGTTCTTG 27 33.00 530
2 nCoV-2019_72_RIGHT 22014 — 22038 ACTCTGAACTCACTTTCCATCCAAC 25 44.00
3 nCoV-2019_73_LEFT 21962 — 21990 CAATTTTGTAATGATCCATTTTTGGGTGT 29 31.03 384
4 nCoV-2019_73_RIGHT 22327 — 22346 CACCAGCTGTCCAACCTGAAGA 22 54.55
5 nCoV-2019_74_LEFT 22263 — 22290 ACATCACTAGGTTTCAAACTTTACTTGC 28 35.71 387
6 nCoV-2019_74_RIGHT 22627 — 22650 GCAACACAGTTGCTGATTCTCTTC 24 45.83
7 nCoV-2019_75_LEFT 22517 — 22542 AGAGTCCAACCAACAGAATCTATTGT 26 38.46 386
8 nCoV-2019_75_RIGHT 22878 — 22903 ACCACCAACCTTAGAATCAAGATTGT 26 38.46
9 nCoV-2019_76_LEFT_alt3 22799 — 22821 GGGCAAACTGGAAAGATTGCTGA 23 47.83 413
10 nCoV-2019_76_RIGHT_alt0 23190 — 23212 ACCTGTGCCTGTTAAACCATTGA 23 43.48
11 nCoV-2019_77_LEFT 23123 — 23144 CCAGCAACTGTTTGTGGACCTA 22 50.00 399
12 nCoV-2019_77_RIGHT 23501 — 23522 CAGCCCCTATTAAACAGCCTGC 22 54.55
13 nCoV-2019_78_LEFT 23444 — 23466 CAACTTACTCCTACTTGGCGTGT 23 47.83 403
14 nCoV-2019_78_RIGHT 23823 — 23847 TGTGTACAAAAACTGCCATATTGCA 25 36.00
15 nCoV-2019_79_LEFT 23790 — 23812 GTGGTGATTCAACTGAATGCAGC 23 47.83 379
16 nCoV-2019_79_RIGHT 24146 — 24169 CATTTCATCTGTGAGCAAAGGTGG 24 45.83
17 nCoV-2019_80_LEFT 24079 — 24100 TTGCCTTGGTGATATTGCTGCT 99 45.45 388
18 nCoV-2019_80_RIGHT 24444 — 24467 TGGAGCTAAGTTGTTTAACAAGCG 24 41.67
19 nCoV-2019_81_LEFT 24292 — 24416 GCACTTGGAAAACTTCAAGATGTGG 25 44.00 497
20 nCoV-2019_81_RIGHT 24766 — 24789 GTGAAGTTCTTTTCTTGTGCAGGG 24 45.83
21 nCoV-2019_82_LEFT 24697 — 24721 GGGCTATCATCTTATGTCCTTCCCT 25 48.00 379
22 nCoV-2019_82_RIGHT 25053 — 25076 TGCCAGAGATGTCACCTAAATCAA 24 41.67
23 nCoV-2019_83_LEFT 24979 — 25003 TCCTTTGCAACCTGAATTAGACTCA 25 40.00 390
24 nCoV-2019_83_RIGHT 25401 — 25369 TTTGACTCCTTTGAGCACTGGC 22 50.00

Таблица 9. Рекомендуемые условия проведения реакции амплификации при использовании праймеров из протокола ARTIC v3. <*>

Матричный режим 1 этап 3 этап <*> 5 этап 6 этап
95 °C — 30 с 95 °C — 30 с

55 °C — 10 с

72 °C — 40 с

30 — 35 циклов

72 °C — 2 мин 10 °C — хранение

<*> Данный температурный режим указан для протокола на основе  High-Fidelity DNA Polymerase. При использовании других ферментов может потребоваться проведение оптимизации условий реакции.

При невозможности использования праймеров из протокола ARTIC v.3 предлагается использовать альтернативный набор праймеров из протокола ЦНИИЭ (неопубликованные данные) или отдельные праймеры, см. таблица 10.

Таблица 10. Нуклеотидные последовательности и позиции в геноме олигонуклеотидных праймеров для секвенирования гена S SARS-CoV-2 (протокол ЦНИИЭ).

Название праймера Позиция Последовательность 5′-3′ Длина Длина ампликона, пн
Cacv51_F 21420 — 21440 AAG GGG TAC TGC TGT TAT GTC 21 795
Cacv51_R 22195 — 22214 GAG GGA GAT CAC GCA CTA AA 20
Cacv52_F 22016 — 22037 TGG ATG GAA AGT GAG TTC AGA G 22 526
Cacv52_R 22518 — 22541 CAA TAG ATT CTG TTG GTT GGA CTC 24
Cacv55_F 22407 — 22430 ATG GAA CCA TTA C AG ATG CTG TAG 24 585
Cacv55_R 22971 — 22991 TAC CGG CCT GAT AGA TTT CAG 21
Cacv07_F 22842 — 22861 ATG ATT TTA CAG GCT GCG TT 20 637
Cacv08_R 23072 — 23091 CCT GTA GAA TAA ACA CGC CA 20
Cacv81_F 23261 — 23282 AGA GAC ATT GCT GAC ACT ACT G 22 585
Cacv81_R 23821 — 23845 TGT ACA AAA ACT GCC ATA TTG CAA C 25
Cacv82_F 23684 — 23709 TCT AAT AAC TCT ATT GCC ATA CCC AC 26 538
Cacv82_R 24200 — 24221 TCC AAC CAG AAG TGA TTG TAC C 22
Cacv83_F 24122 — 24145 AAG TTT AAC GGC CTT ACT GTT TTG 24 592
Cacv83_R 24690 — 24713 ACA TAA GAT GAT AGC CCT TTC CAC 24
Cacv84_F 24587 — 24611 ACT CAA CAA TTA ATT AGA GCT GCA G 25 585
Cacv84_R 25149 — 25171 AAG TTC TTG GAG ATC GAT GAG AG 23
Cacv85_F 24810 — 24833 ATG ATG GAA AAG CAC ACT TTC CTC 24 666
Cacv09_R 25281 — 25300 AAA TCT GAA GGA GTA GCA TCC TTG 24

Рекомендуемые условия проведения реакции амплификации при использовании праймеров из протокола ЦНИИЭ приведены в таблице 11.

Таблица 11. Рекомендуемые условия проведения реакции амплификации при использовании праймеров из протокола ЦНИИЭ.

Матричный режим 1 этап 3 этап <*> 5 этап 6 этап
95 °C — 5 мин 95 °C — 30 с

52 °C — 30 с

72 °C — 60 с

30 — 35 циклов

72 °C — 5 мин 10 °C — хранение

<*> Данный температурный режим указан для протокола на основе Taq-полимеразы. При использовании других ферментов может потребоваться проведение оптимизации условий реакции.

Допустимо также использовать праймеры из иных протоколов, позволяющие проводить амплификацию и последующее фрагментное секвенирование последовательности S-гена SARS-CoV-2.

3. Алгоритм дифференциации генетических вариантов вируса SARS-CoV-2 с помощью проведения полногеномного секвенирования

Для заключения о геноварианте SARS-CoV-2 в исследованной пробе рекомендуется использовать алгоритм классификации PANGOLIN (https://cov-lineages.org/).

Для секвенирования полной последовательности геномов SARS-CoV-2 рекомендуется использовать (на выбор) праймерную панель и протокол подготовки библиотек:

— ARTIC v.3 https://www.protocols.io/view/ncov-2019-sequencing-protocol-bbmuik6w

— SCV-2000bp https://www.protocols.io/view/protocol-for-scv-2000bp-a-primer-panel-for-sars-co-bn77mhrn.html

— любые иные праймерные панели и протоколы, позволяющие осуществить амплификацию полного генома SARS-CoV-2″.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *